Skip to content

FOXP3 jest nowym represorem transkrypcyjnym dla onkogenu SKP2 raka sutka ad 7

2 tygodnie ago

725 words

Dane te wskazują, że represja za pośrednictwem FOXP3 prawdopodobnie służy jako ważny strażnik dla nadekspresji SKP2 in vivo. Należy zauważyć, że, jak często obserwowano w próbkach klinicznych, nie ma korelacji 1: między ekspresją FOXP3 a brakiem SKP2 w raku sutka. Podobnie, nie wszystkie FOXP3. nowotwory z nadekspresją SKP2. Tak więc, oprócz FOXP3, inne czynniki również przyczyniają się do ekspresji SKP2. Warto zauważyć, że w niedrobnokomórkowym raku płuca nadekspresja Skp2 jest związana z amplifikacją genu Skp2 (18). Potrzebne są dodatkowe badania, aby określić, czy FOXP3 może osłabiać ekspresję SKP2 w przypadku amplifikacji genu, co wykazaliśmy w amplifikacji genu HER2 (7). Podsumowując, analiza genetyczna, biochemiczna i funkcjonalna dostarcza mocnych dowodów na to, że Foxp3 jest represorem transkrypcyjnym onkogenu SKP2. Identyfikacja istotnie ważnego celu innego niż Her2 wyjaśnia, dlaczego Foxp3 również hamuje wzrost MCF-7, linii komórkowej raka piersi bez nadekspresji HER2 / ERBB2. Metody Linie komórkowe, eksperymentalne zwierzęta i mikromacierze tkanek ludzkich. HMEC (HMEC-1; CC-2551) i podłoże wzrostowe komórek nabłonka sutka (MEGM; CC-3051) zakupiono od Cambrex Clonetics. TSA jest agresywną i słabo immunogenną linią komórkową ustaloną z pierwszego przeszczepu in vivo umiarkowanie zróżnicowanego gruczolakoraka sutka, który powstał spontanicznie u myszy BALB / c (31). Linię komórkową raka piersi MCF-7 zakupiono od ATCC. Samice myszy heterozygotycznych pod względem mutacji Scurfy (Foxp3sf / +) były krzyżowane wstecznie z tłem BALB / c przez co najmniej 12 pokoleń w University of North Carolina (Chapel Hill, North Carolina, USA). Zwierzęta trzymano w laboratoryjnym laboratorium dla zwierząt na Ohio State University i University of Michigan w warunkach specyficznych dla wolnych od patogenów. Spontaniczne obserwacje zachorowalności na nowotwory i wywołane przez nie nowotwory zostały zweryfikowane i zatwierdzone przez The Ohio State University i University of Michigan Institutional Animal Care and Use Committees. Normalne i rakowe tkanki sutków otrzymano z The University of Pathology Bank of Pathology w Ohio, Zymed Laboratories Inc. i US Biomax Inc. Antibodies. Oczyszczono oczyszczone na podstawie powinowactwa królicze przeciwciała anty-Foxp3, specyficzne dla peptydu N-końca FOXP3 rozpoczynającego się w pozycji 25 ([C] LLGTRGSGGPFQGRDLRSGAH), jak również przeciwciała do barwienia immunohistochemicznego i Western blotting (p27 [M-197, 1]. : 500, Santa Cruz Biotechnology Inc.], SKP2 [H-435, 1: 100, Santa Cruz Biotechnology Inc.]). Wektor lentiwirusowy wyciszający FOXP3. Wektory ekspresyjne siRNA oparte na lentiwirusach wytworzono przez wprowadzenie mysiego promotora polimerazy RNA III U6 i kasety ekspresyjnej EGFP kinazy mysiego promotora kinazy fosfoglicerydowej (pGK) do wektora szkieletu pLenti6 / V5-D-TOPO bez promotora CMV. Sekwencja siRNA typu szpilki do włosów dla FOXP3 (sekwencja docelowa w regionie od 1256 do 1274 nukleotydów; 5a-GCAGCGGACACTCAATGAG-3a) została sklonowana do lentiwirusowych wektorów ekspresyjnych siRNAa przez miejsca restrykcyjne ApaI i EcoRI. Żeton. ChIP przeprowadzono zgodnie z opublikowaną procedurą (32). W skrócie, komórki transfekowane TSA Foxp3-V5a sonikowano i utrwalono 1% paraformaldehydem. Przeciwciała przeciwko V5 lub kontrolne mysie IgG użyto do usunięcia chromatyny związanej z Foxp3-V5. Ilości specyficznego fragmentu DNA oznaczono ilościowo metodą PCR w czasie rzeczywistym i znormalizowano względem preparatu genomowego DNA z tych samych komórek. Poniżej przedstawiono primery PCR w czasie rzeczywistym ChIP z wcześniejszego Skp2: ChIP-1 forward, TGTGATGGGCACACATACAG; reverse, TGTTCTCTGGAAGCCTCAGC; ChIP-2 do przodu, CGAATCTTGCTCTCTCCACA; reverse, CATGCAAAATTCAGGTGTGC; ChIP-3 do przodu, GGACAGGCTGTGGATTGAGT; reverse, CCAAGAGGAGCGATGGTTTA; i ChIP-4 do przodu, TGCTGGGACTTTTCTCCACT; reverse, AGACACCCATGCCTGATAGC; Skp2 forward, TTAGTCGGGAGAACTTTCCAGGTG; Skp2 reverse, AGTCACGTCTGGGTGCAGATTT. Immunohistochemia. Ekspresję Foxp3 i Skp2 w próbkach myszy i ludzi z rakiem piersi określono przy użyciu immunohistochemii, jak opisano. Próbki składające się z ponad 5% komórek z ekspresją jądrową Foxp3 oceniono jako dodatnie. Punktacja SKP2 była zgodna z poprzednim opisem (12-15): te z więcej niż 5% albo dodatnich nagromadzeń jądrowych albo pozytywnych względem cytoplazmy oceniono jako Skp2 +. Barwienie FOXP3 i SKP2 oceniano podwójnie ślepymi. Test tworzenia kolonii. Test tworzenia kolonii przeprowadzono jak opisano wcześniej (7). Przeciwciała, immunoprecypitacja i Western blot Przeciwciała specyficzne dla SKP2 (Santa Cruz Biotechnology Inc.) i p27 (Cell Signaling) zastosowano do immunoprecypitacji i / lub Western blot. Zastosowano specjalną procedurę w celu wykrycia polubikwitynowanego p27, zgodnie z tym, co opisali Ji i in. (33), stosując sprzężoną z HRP ubikwitynę (Ub P4D1) (sc-8017, Santa Cruz Biotechnology Inc.). Statystyka. Porównania między dwiema grupami przeprowadzono przy użyciu niesparowanego dwustronnego testu ucznia. Test ANOVA zastosowano do analizy wariancji pomiędzy kilkoma grupami. Do analizy użyto testu. 2. Wszystkie wartości są przedstawione jako średnie. SD. Różnice między grupami uznano za statystycznie istotne przy P <0,05. Podziękowania Dziękujemy Timowi Huangowi za wsparcie oraz Lynde Shaw i Todd Brownowi za pomoc sekretarską. Badanie to jest wspierane przez granty z NIH i Departamentu Obrony. Przypisy Niestandardowe skróty: ChIP, immunoprecypitacja chromatyny; FOXP3, skrzynia z widłami P3; HMEC, ludzka komórka nabłonka sutka; SKP2, białko związane z kinazą fazy S 2. Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów. Informacje referencyjne: J. Clin. Invest.117: 3765. 3773 (2007). doi: 10.1172 / JCI32538 Tao Zuo i Runhua Liu w równym stopniu przyczynili się do tej pracy. Obecny adres Tao Zuo: Departament Wirusologii Molekularnej, Immunologii i Genetyki Molekularnej, Ohio State University, Columbus, Ohio, USA. [hasła pokrewne: fit med, dieta dukana przepisy faza 1, portius krosno godziny otwarcia ] [patrz też: młody jęczmień green ways, niedobór witaminy d u dorosłych objawy, leczenie kanałowe białystok ]